There are multiple valid protocols available for amplicon sequencing on Illumina and AVITI systems.
Here we present one of many options; a protocol published by Illumina. It is a two-step PCR protocol generating complete sequencing libraries. This protocol has the advantages, that it does not require custom sequencing primers and that the barcode-indexing oligos can be re-used for multiple different amplicons and future projects. We suggest following a "16S amplicon" protocol that was designed by Illumina explicitly to be adaptable to other targets (please see the full protocol and pages 3 and 4 here). Once you have designed the oligos as described in the Illumina protocol (forward overhang plus your sequence-specific primer as well as reverse overhang plus sequence-specific primer), we suggest checking these sequences on the IDT oligo analyzer ( https://www.idtdna.com/calc/analyzer ) for secondary structures. It is advisable to avoid any sequences that generate a Delta G smaller than -9 for any of the structures.
You will have two options for barcode-indexing:
1) UDI adapter primers. UDI stands for uniquely dual indexed. This is the recommended and safest version of indexing, since barcode indexing artifacts will be removed from the data during demultiplexing (please see this FAQ). The easiest way to use this approach is to order "IDT for Illumina DNA/RNA UD Indexes". A total of 384 UDIs are available in plates of 96 each.
2) Combinatorial indexing. This is the cheaper option, especially for large-scale projects. This approach is more prone to index misassignments as in the FAQ above. Combinations of the 26x18 adapter sequences in the linked document can identify 468 samples. Low-cost desalted oligos can be ordered for this purpose anywhere. The sequences for the index primers (twentysix i7 "index 1" sequences; eighteen i5 "index 2" sequences) are available on pages 4, 15 and 16 here. When ordering oligos please use the index sequences in the "Bases in Adapter" columns. We strongly recommend preparing plates with single-reaction aliquots of these index primers for your experiments, to assure that index primer stocks cannot become cross-contaminated.
Combinatorial indexing is NOT recommended for all recent Illumina sequencers. When sequencing on the AVITI please try to use as many different i7 "index 1" sequences as possible.
When following the Illumina protocol linked above, your first-round PCR amplicon products will have universal tails/tags/overhangs on both ends. You should always employ dual indices. If you are using single indices they have to be i7 (P7 adapter) indices. The provided first-round PCR primer designs use Nextera-style tag sequences (overhang sequences) and look like this:
Forward overhang (P5-tag): 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific sequence]
Reverse overhang (P7-tag): 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus-specific sequence]
The second-round PCR primers are Nextera-style index primers - i5 and i7 indicate the location of the barcode index sequences:
P5-PCR index primer: 5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
P7-PCR index primer: 5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Please optimize the conditions of the first-round PCR to avoid primer-dimer generation. All PCR reactions should be cleaned up with Ampure XP beads (or similar SPRI beads) and resuspended in EB buffer. The final concentration of the index primers for the second round indexing PCR is usually 0.5 uM each. Once you have verified (via agarose gel electrophoresis) that the PCR products for all samples are clean and show the same expected fragment sizes, the samples should be quantified via fluorometry (e.g. Qubit) and pooled equimolarly.
Amplicon-sequencing optimization - recommended only for advanced users:
In case you are targeting only a single amplicon, it helps to create sequence diversity by adding a set of PCR primers with added diversity spacer "N" bases (or defined bases; up to seven of them) between the overhangs for both forward and reverse primers (e.g. Fadrosh et al. 2014, Wu et al. 2015). The resulting set of primers should be pooled in equimolar ratios and used for the first round of PCR. These protocols will generate increased base-diversity of the sequencing libraries, by stacking the amplicon start sites, resulting in higher accuracy sequencing data.
The original Illumina design looks like this: overhang+locus-spec. sequence (no spacer):
5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus‐specific sequence]
Complementary stagged spacer versions of this oligo would be:
One spacer base added: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐X-[locus‐specific sequence]
Two spacer bases added: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐XX-[locus‐specific sequence]
Three spacer bases added: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐XXX-[locus‐specific sequence]
Four spacer bases added: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐XXXX-[locus‐specific sequence]
Five spacer bases added: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐XXXXX-[locus‐specific sequence]
Six spacer bases added: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐XXXXXX-[locus‐specific sequence]
Seven spacer bases added: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐XXXXXXX-[locus‐specific sequence]Knowing the locus-specific sequence one can certainly be smarter and make the two "N"s directly before the locus‐specific sequence different from the first two bases of the locus‐specific sequence (Fadrosh et al. 2014). If pooling amplicons for multiple targets (more than 8) there is no advantage using diversity spacers.
Some data analysis software might require the removal of the diversity spacers. dbcAmplicons can demultiplex the data as well as trim/remove the diversity spacer.
Fungal ITS: Illumina has published a second version of this protocol, modified to sequence and study fungal ITS sequences.
Qiagen offers a commercial amplicon prep kit for multiple 16S regions and ITS for which they have perfected the diversity spacer approach described above. This kit eliminates the need for PhiX spike-ins. A much more detailed protocol for 16S and other amplicon sequencing is available here: Gohl et al. 2016 Please see this page for the library requirements for sequencing (https://dnatech.genomecenter.ucdavis.edu/sample-requirements/). The above protocol will generate a surplus of library material.