Can I use custom sequencing primers? What melting temperatures should these have?

Please note that custom sequencing primers are not supported by Illumina — the company will not replace sequencing kits on run failures. Nevertheless, custom sequencing primers can enable some unique assays. It is certainly worth exploring if assays can’t be converted to use standard Illumina sequencing primers since standard primers are more or less guaranteed to work.  Please also see the amplicon sequencing FAQ and note that the client carries the responsibility for any failures due to bad custom primer oligos or poorly designed custom primers.

On MiSeq sequencers custom sequencing primers can be used for three of the reads (forward, reverse, & index 1 reads). On the NextSeq 2000, custom sequencing primers can be used for all four reads (forward, reverse, & index 1 & 2 reads); Illumina does not support custom primers on the NovaSeqs.

For Illumina Sequencers: Please provide an aliquot for each custom primer with each library submission — 10 ul at 100 uM in EB buffer; low-bind tubes. Custom sequencing primers should be ordered HPLC purified to remove any incomplete oligos.

For the Element Bio AVITI sequencer: Please provide an aliquot for each custom primer with each library submission — 30 ul at 100 uM in low-TE buffer for index 1, index 2, and read 2 sequencing primers; 40 ul at 100 uM in low-TE buffer for read 1 sequencing primers; low-bind tubes. Custom sequencing primers should be ordered HPLC purified to remove any incomplete oligos.

When designing custom sequencing primers, the melting temperature needs to be considered (among other criteria). For example, on the NextSeq and AVITI the minimum sequencing primer annealing temperature is 60°C, whereas on the MiSeq it is 65°C. It is suggested to calculate it with the IDT oligo analyzer for the default buffer conditions (50 mM Na+; spec-sheet conditions). While at the oligo analyzer site also check the designs for secondary structures, potential hairpin and self-dimers. If the melting temperatures of your design are too low, the Tm can potentially be increased by inserting interspersed LNA bases into custom LNA oligos available from Qiagen. Avoid clustering of LNA bases and do not substitute the two last 3′ bases. LNA oligos are significantly more expensive than conventional oligos.

Here is the custom primer guidance for the AVITI (also helpful for Illumina):

  • Properties:
    • Tm ≥ 60°C   (at 50 mM Na+; e.g. IDT spec-sheet conditions)
    • Length ~25–35 bp
    • GC content ~45–60%
    • No risk of significant 2° structures, (e.g., homodimers, hairpin loops, etc.)
    • Spans any initial constant regions so sequencing begins in a high diversity region
    • HPLC purified is preferred


For more info please see this guide from Illumina: miseq-system-custom-primers-guide-15041638-01 and also the index read guide: indexed-sequencing-overview-guide-15057455-04-Illumina-pages1to8

Please note that the 2nd-index read is primed from a flowcell-bound oligo for the Miseq and most other Illumina sequencers.  Thus, it cannot be customized. The sequencing of the second index begins with exactly seven dark cycles for which no sequence is recorded. Thus, the first base of the 2nd index sequence has to be the 30th nucleotide from the P5 end of the library molecule for most applications. Please note this FAQ can’t be a comprehensive guide to custom sequencing primer design and usage. 

 
Small RNA-seq / miRNA-seq on the AVITI with libraries employing TruSeq Small RNA sequencing adapters

Truseq Small RNA libraries will require custom sequencing primers on the AVITI. In most cases there will be no need for a reverse read, thus only TruSeq Small RNA Read 1 and  i7/Index 1 custom sequencing primers will be required.

10x Specific recommendations: If using 10X Index Primer Set TS (i.e. Single Cell Gene Expression Flex or Visium FFPE), a spike-in of the TruSeq Small RNA sequencing primer will be required.

Primer NameSequence (5′ -> 3′)Tm (C)Length (nt)
TruSeq Small RNA Read 1ATCTACACGTTCAGAGTTCTACAGTCCGACGATC6534
TruSeq Small RNA Read 2GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA6833
i7/Index 1TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC6833
i5/Index 2Use Adept Index 2 Primer

Common buffers for DNA samples, RNA samples, and primers are:
EB-Buffer: 10mM TRIS (pH= 8.0-8.4) e.g. Qiagen EB Buffer
EBT-Buffer: 10mM TRIS, 0.1%Tween20 (pH=8.0-8.4)
TE-Buffer: 10mM TRIS, 1 mM EDTA (pH=8.0-8.4)
Low-TE buffer or TLE-Buffer: 10mM TRIS, 0.1 mM EDTA (pH=8.0-8.4)
All should be free of DNases and RNases.